View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2666_high_10 (Length: 250)
Name: NF2666_high_10
Description: NF2666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2666_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 14 - 237
Target Start/End: Original strand, 35553103 - 35553308
Alignment:
| Q |
14 |
aatcaaaaatggttttttcattgttcatcacttcatcaccattgaatgtggctgtggctgtggctgtggctgttcataggacaattgaaagggtcatatc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35553103 |
aatcaaaaatggttttttcattgttcatcacttcatcaccattgaatgtg------------------gctgttcataggacaattgaaagggtcatatc |
35553184 |
T |
|
| Q |
114 |
tcgtgagtgacttaaaattgatgaataatatgtgtacacatagtgtttatctttttaggtgcctagtttaacctttcaacttttgtactttatgctcttg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35553185 |
tcgtgagtgacttaaaattgatgaataatatgtgtacacatagtgtttatctttttaggtgcctagtttaacctttcaacttttgtactttatgctcttg |
35553284 |
T |
|
| Q |
214 |
agtttgcataactcatgcttttct |
237 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
35553285 |
agtttgcataactcatgcttttct |
35553308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University