View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2666_low_14 (Length: 233)
Name: NF2666_low_14
Description: NF2666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2666_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 214
Target Start/End: Original strand, 43205198 - 43205395
Alignment:
| Q |
17 |
ataattcttggattgtgatttcaacatgtggcgcgttatcaacttcgacaacaggtttaatgattcctctatgaagtaggtgtggcttctctggtgagac |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43205198 |
ataaatcttggattgtgatttcaacatgtgacgcgttatcaacttcgacaacaggtttaatgattcctctatgaagtaggtgtggcttctctggtgagac |
43205297 |
T |
 |
| Q |
117 |
attagattctacactcttgaaatgtgctaaattcgaaagctcagaaacagattcatagattttctccactgagatagtgatttcttcaagtattgcag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43205298 |
attagattctacactcttgaaatgtgctaaattcgaaagctcagaaacagattcatagattttctccactgagatagtgatttcttcaagtattgcag |
43205395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University