View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2666_low_15 (Length: 222)

Name: NF2666_low_15
Description: NF2666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2666_low_15
NF2666_low_15
[»] chr3 (1 HSPs)
chr3 (7-217)||(5357908-5358115)


Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 7 - 217
Target Start/End: Original strand, 5357908 - 5358115
Alignment:
7 atatctcaagcattcataaagtcgaagggtaataaactttacacacatagatgaaaagtaataatttaataaactcattcagagagaaaatcataataca 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||    
5357908 atatctcaagcattcataaagtcgaagggtaataaactttacacaca--gatgaaaagtaataatttaataaactcattcagagagaaaatcataataca 5358005  T
107 ataattgccatttatatctcttctcatctctaatagaagagaaattagctaatcgcgatgttttacagaaacataaatgagcaatgtaaaaattacacgt 206  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||    
5358006 ataattgccatttatttctcttctcatctctaatagaagagaaattagctaatcgcgatgttttacag-aacataaatgagcattgtaaaaattacacgt 5358104  T
207 aaaaatctgtg 217  Q
    |||||||||||    
5358105 aaaaatctgtg 5358115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University