View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2666_low_16 (Length: 217)
Name: NF2666_low_16
Description: NF2666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2666_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 15 - 196
Target Start/End: Complemental strand, 5357830 - 5357647
Alignment:
| Q |
15 |
aagaatattgaagaattatattatatggaaggcattccatatacaagtgttctagcatctcttatgtgtgctatggtcggtacttgtcctgatatagcat |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5357830 |
aagaaaattgaagaattatattatatggaaggcattgcatatacaagtgttttagcatctcttatgtgtgctatggtcagtacttgtcctgatatagcat |
5357731 |
T |
|
| Q |
115 |
atgcagtgagtttagtatccagatttac--aaaaccaactatatttttaaggtgcgtcaaagtatctgacccacgtcagtgtct |
196 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5357730 |
atgcagtgagtttagtatccagatttaccaaaaaccaactatatttttaaggtgcgtcaaagtatctgacccacgtcagtgtct |
5357647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 36 - 88
Target Start/End: Complemental strand, 5372539 - 5372487
Alignment:
| Q |
36 |
tatatggaaggcattccatatacaagtgttctagcatctcttatgtgtgctat |
88 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
5372539 |
tatatggaaggtattccatatacaagtgttttagcatctcttatgtatgctat |
5372487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University