View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2668_high_5 (Length: 328)
Name: NF2668_high_5
Description: NF2668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2668_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 1 - 318
Target Start/End: Original strand, 33081626 - 33081943
Alignment:
| Q |
1 |
tcatcagagcaaccggcccaaaggggatgagctttgaaagcagcttccatattagcaagaaagtcttgtacggcatcactgtctctctcaggatcgggtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33081626 |
tcatcagagcaaccggcccaaaggggatgagctttgaaagcagcttccatattagcaagaaagtcttgtacggcatcactgtctctctcaggatcgggtc |
33081725 |
T |
|
| Q |
101 |
catgatttgaaaatgaaactatgaaactgtaaaattataattattgcaatgcatcagtgaattgattagggttcggattgaaattaagatggtgaaaaga |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33081726 |
catgatttgaaaacgaaactatgaaactgtaaaatcataattattgctatgcatcagtgaattgattagggttcggattgaaattaagatggtgaaaaga |
33081825 |
T |
|
| Q |
201 |
agaaggaaggaaccttttgatagctttgacgaaatcggcggcggcgggttggcgcatgcgctcgaggaagtcgtgtaaaccagaggaagcgtcggcgttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33081826 |
agaaggaaggaaccttttgatagctttgacgaaatcggcggcggcgggttggcgcatgcgctcgaggaagtcgtgtaaaccagaggaagcgtcggcgttt |
33081925 |
T |
|
| Q |
301 |
tccattacactgtctgtg |
318 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
33081926 |
tccattacactgtctgtg |
33081943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University