View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2668_high_7 (Length: 289)
Name: NF2668_high_7
Description: NF2668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2668_high_7 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 166 - 289
Target Start/End: Complemental strand, 52877082 - 52876959
Alignment:
| Q |
166 |
gtcaatcatctaccttaatattaggcaagcgagctaattgcaacactgttatcattaaacatataccctgtaaagaataaagtcgtatttcaagtgaatt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52877082 |
gtcaatcatctaccttaatattaggcaaacgagctaattgcaacactgttatcattaaacatataccctgtaaagaataaaatcgtatttcaagtgaatt |
52876983 |
T |
 |
| Q |
266 |
atgtcaaataaaatcaaatagatt |
289 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
52876982 |
atgtcaaataaaatcaaatagatt |
52876959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 9 - 96
Target Start/End: Complemental strand, 52877246 - 52877159
Alignment:
| Q |
9 |
gatatgaatacccaaaagatatcatatacaaatgcgcaacaaaggagtacagttgcgacctaagacatcaaatgcacatgaaaatgat |
96 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52877246 |
gatatgaatacccaaaagatgtcatatacaaatgcgcaacaaaggagtacagttgcgacctaagacatcaaatgcacatgaaaatgat |
52877159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University