View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2668_high_9 (Length: 256)
Name: NF2668_high_9
Description: NF2668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2668_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 66 - 213
Target Start/End: Complemental strand, 32000642 - 32000495
Alignment:
| Q |
66 |
gtgatgaaattgagggtgatgcagttgatgaaattgaagattttcccatcacgctgtcagataatgacaccattttctagtaaaaggtcattctggattc |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32000642 |
gtgatgaaattgagggtgatgcagttgatgaaattgaagattttcctatcacgctgtcagataatgacaccattttctagtaaaaggtcattctggattc |
32000543 |
T |
|
| Q |
166 |
acaccgattagatcaaaaacccaaaagtatcctttgagattaaataga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32000542 |
acaccgattagatcaaaaacccaaaagtatcccttgagattaaataga |
32000495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University