View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2668_low_17 (Length: 251)
Name: NF2668_low_17
Description: NF2668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2668_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 213 - 250
Target Start/End: Complemental strand, 12677622 - 12677585
Alignment:
| Q |
213 |
tattgtgtaattttctgtaacttttttatggtgctctt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12677622 |
tattgtgtaattttctgtaacttttttatggtgctctt |
12677585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 213 - 247
Target Start/End: Original strand, 33412656 - 33412690
Alignment:
| Q |
213 |
tattgtgtaattttctgtaacttttttatggtgct |
247 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
33412656 |
tattgtgtaattttatgtaacttttttatggtgct |
33412690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University