View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2668_low_7 (Length: 318)
Name: NF2668_low_7
Description: NF2668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2668_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 158 - 265
Target Start/End: Complemental strand, 54803033 - 54802926
Alignment:
| Q |
158 |
taaaattttcttctcaacttgagtaataacccgtccttttcattttaacttgagtaataactttccaccacaaatagctcatgaaacacacctctatttc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54803033 |
taaaattttcttctcaacttgagtaataacctgtccttttcattttaacttgagtaataactttccaccacaaatagctcatgaaacacacctctatttc |
54802934 |
T |
 |
| Q |
258 |
atctcact |
265 |
Q |
| |
|
||| |||| |
|
|
| T |
54802933 |
atcacact |
54802926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 97 - 166
Target Start/End: Complemental strand, 54803487 - 54803418
Alignment:
| Q |
97 |
ataacaatattatggtgtcaccatggtttcgtcaatttcatttgcccgtataatcatgctataaaatttt |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
54803487 |
ataacaatattatggtgtcaccatggtttcgtcaatttcatttgcccatataatcatgctataaaatttt |
54803418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University