View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2669_low_4 (Length: 249)
Name: NF2669_low_4
Description: NF2669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2669_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 10 - 116
Target Start/End: Original strand, 44193288 - 44193394
Alignment:
| Q |
10 |
attatacttctaaaattaaattatatatgtaaaaatagaactcaccttcacatcttcattggcaccttcttgtgaagaattgagattctgccataaaccc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44193288 |
attatacttctaaaattaaattatatatgtaaaaatagaactcaccttcacatcttcattggcaccttcttgtgaagaattgagattctgccataaaccc |
44193387 |
T |
 |
| Q |
110 |
tcttcct |
116 |
Q |
| |
|
||||||| |
|
|
| T |
44193388 |
tcttcct |
44193394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 190 - 249
Target Start/End: Original strand, 44193467 - 44193526
Alignment:
| Q |
190 |
gaaggaactgaatcccaaaaatttgaaattaccttaagctcctgtagagcaacaggaatt |
249 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44193467 |
gaaggaactgaatcccaaaaaattgaaattaccttaagctcctgtagagcaacaggaatt |
44193526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University