View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2669_low_6 (Length: 230)
Name: NF2669_low_6
Description: NF2669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2669_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 24 - 213
Target Start/End: Complemental strand, 38932998 - 38932815
Alignment:
| Q |
24 |
gacaatgtctttgttgatattatagaagatgaactcacatttatctaccttaaccatgagaagatgaactcacagtcacattcgttgaacttgtnnnnnn |
123 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38932998 |
gacaatgtctttgttgatattatataagatgaactcacatatatctaccttaaccatgagaagatgaactcaca------ttcgttgaacttgtaaaaaa |
38932905 |
T |
 |
| Q |
124 |
nnttggcaccgctgcggcattaatgaaagcatgatgaggtgtaagaatgaagggtttgatatgcatgcatggtgaagaatgtccacattg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932904 |
aattggcaccgctgcggcattaatgaaagcatgatgaggtgtaagaatgaagggtttgatatgcatgcatggtgaagaatgtccacattg |
38932815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University