View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2670_high_6 (Length: 267)
Name: NF2670_high_6
Description: NF2670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2670_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 17 - 257
Target Start/End: Complemental strand, 5995301 - 5995061
Alignment:
| Q |
17 |
aactaaaagttggggacttggacctgtttctttatgggctaatcaagatgattcagataaagctgcaagagggtatgcaaagaaagaagaaggtgcaaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5995301 |
aactaaaagttggggacttggacctgtttctttatgggctaatcaagatgattcagataaagctgcaagagggtatgcaaggaaagaagaaggtgcaaaa |
5995202 |
T |
 |
| Q |
117 |
gaagaagggtggttgaaatggttgaattcaaaaccagatggttctgttttatatgtaagttttggcagtatgaataaatttccttattctcagttagttg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5995201 |
gaagaagggtggttgaaatggttgaattcaaaaccagatggttctgttttatatgtaagttttggcagtatgaataaatttccttattctcagttagttg |
5995102 |
T |
 |
| Q |
217 |
aaattgcacatgcacttgaagattcaggtcataatttcatt |
257 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5995101 |
aaattgcacatgcacttgaaaattcaggtcataatttcatt |
5995061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 158 - 257
Target Start/End: Original strand, 26260335 - 26260434
Alignment:
| Q |
158 |
ttctgttttatatgtaagttttggcagtatgaataaatttccttattctcagttagttgaaattgcacatgcacttgaagattcaggtcataatttcatt |
257 |
Q |
| |
|
|||||| || |||||||||||||| || ||| || || ||||| ||||| | |||||||| || |||| ||||||| |||||||||||||||||||| |
|
|
| T |
26260335 |
ttctgtgttgtatgtaagttttggaagcttgactaggctttcttatgctcaggttgttgaaatagctcatggacttgaaaattcaggtcataatttcatt |
26260434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University