View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2670_low_13 (Length: 235)
Name: NF2670_low_13
Description: NF2670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2670_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 33 - 221
Target Start/End: Original strand, 46559277 - 46559465
Alignment:
| Q |
33 |
taaaatactaaaagatagtatttgaagtaaatcgccctagtattgtcttaaaaccctacaataaaaataacatcgtcttggatattggttttgtttttaa |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46559277 |
taaaatactaaaagatagtatttgaagtaaatcgccctagtattgtcttaaaaccctacaataaaaataacatcgtcttggatattggttttgtttttaa |
46559376 |
T |
|
| Q |
133 |
tctgtattagaatgtaataacccaaatatatcaacgctgtttcactgttccattgttcctaatctatccttcctttacctggatctttt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46559377 |
tctgtattagaatgtaataacccaaatatatcaacgctgtttcactgttccattgttcctaatctatccttcctttacctggatctttt |
46559465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 46555471 - 46555503
Alignment:
| Q |
1 |
ataatctttataaattggcatggccatgagtat |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
46555471 |
ataatctttataaattggcatggccatgagtat |
46555503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University