View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2671_low_14 (Length: 337)
Name: NF2671_low_14
Description: NF2671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2671_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 1 - 316
Target Start/End: Complemental strand, 42623604 - 42623289
Alignment:
| Q |
1 |
gaaaagggtagaaggttttggaaggaaaaaggagaaagaattcgagagaaatctagacactatacccgcttcctcaatattatttcttcccacctttttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42623604 |
gaaaagggtagaaggttttggaaggaaaaaggagaaagaattcgagagaaatctagacactatacccgcttcctcaatattatttcttcccacctttttt |
42623505 |
T |
|
| Q |
101 |
cgtttctctttcataatataattcattcaatttcaacaaacaactcaacactctacaaaccctaattttgatctgtgtaacggttaacatggcttcttct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42623504 |
agtttctctttcataatataattcattcaatttcaacaaacaactcgacactctacaaaccctaattttgatctgtgtaacggttaacatggcttcttct |
42623405 |
T |
|
| Q |
201 |
ggacacttcaagttgttgaagaggaaattcgatggcaccgtcgttcaaatcggtgacgatttctccgatttctctctttcttctccggctactaaaattc |
300 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42623404 |
ggacacttcaagttgttgaagaggaaactcgatggcaccgtcgttcaaatcggtgacgatttctccgatttctctctttcttctccggctactaaaattc |
42623305 |
T |
|
| Q |
301 |
gccgcctcgtacgtac |
316 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
42623304 |
gccgcctcgtacgtac |
42623289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University