View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2672_high_1 (Length: 250)
Name: NF2672_high_1
Description: NF2672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2672_high_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 18605661 - 18605470
Alignment:
| Q |
1 |
acatataagaatctacattttaacccttgtttgaagattcttcatataaaataaattctaatttctcaatcctacaccgaaataaatggtaattatattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18605661 |
acatataagaatctacattttaacccttgtttgaagattcttcgtataaaataaattcaaatttctcaatcctacaccgaaataaatggtaattatattt |
18605562 |
T |
 |
| Q |
101 |
attttttaagaatgtgaagatgtactagaacaatggaccttaatccatcatcttctttagtgctcttttgatagagtttgccgtttcacccc |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18605561 |
attttttaagaatgtgaagatgtactagaacaatggaccttaatccatcatcttctttagttctcttttgatagagtttgccgtttcacccc |
18605470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 166 - 237
Target Start/End: Complemental strand, 18605459 - 18605388
Alignment:
| Q |
166 |
ttttgatagagtttgccgtttcacccctgtttcttgggaaacttcccatgaccgagcttgcttcctctattc |
237 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18605459 |
ttttgatagagtttgccatttcacccctgtttcttgggaaacttcccatgaccgagcttgcttcctctattc |
18605388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University