View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2672_high_3 (Length: 305)

Name: NF2672_high_3
Description: NF2672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2672_high_3
NF2672_high_3
[»] chr8 (1 HSPs)
chr8 (216-290)||(41291183-41291257)


Alignment Details
Target: chr8 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 216 - 290
Target Start/End: Complemental strand, 41291257 - 41291183
Alignment:
216 cttttatttttgtcgagacacactttcttaataatgtgtaatgtttccattagctaaactaaaaattgaaatcat 290  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41291257 cttttatttttgtcgagacacactttcttaataatgtgtaatgtttccattagctaaactaaaaattgaaatcat 41291183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University