View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2672_low_12 (Length: 283)
Name: NF2672_low_12
Description: NF2672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2672_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 34085100 - 34085283
Alignment:
| Q |
1 |
ctccaatatcatttgaagtatagagtttcgaaaatcttcatacggctccttggattccttctcaacggcaatgctatctatgagttttgtagccggcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34085100 |
ctccaatatcatttgaagtatagagtttcgaaaatcttcatacggctccttggattccttctcaacggcaatgctatctatgagttttgtagccggcttt |
34085199 |
T |
|
| Q |
101 |
aaaatcctataattattattgttgtcgtttgagatggtggtggaagtgaaatctttgtcaccggtgttggcgtcgtgggaagtg |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34085200 |
aaaatcctataattattattgttgtcgtttgagatggtggtggaagtgaaatctttgtcatgggtgttggcgtcgtgggaagtg |
34085283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University