View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2672_low_14 (Length: 255)
Name: NF2672_low_14
Description: NF2672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2672_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 45 - 228
Target Start/End: Complemental strand, 7805056 - 7804873
Alignment:
| Q |
45 |
aagtctgaaatctactataatagaaatgtgtccaccaatgttaagaatttagttgcaaataatttggggtatgcaacaagtgttaggtactagtaaatat |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7805056 |
aagtctgaaatctactataatagaaatgtgtccaccaatgttaagaatttagttgcaaataatttgggatatgcaacaagtgttaggtactagtaaatat |
7804957 |
T |
|
| Q |
145 |
cttgggttaccctcaatggttgggaggagtataaaatcaacttcaaattcatcaaggataaagtttcgaagaaagttagtagtg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7804956 |
cttgggttaccctcaatggttgggaggagtataaaatcaacttcaaattcatcaaggataaagtttcgaagaaagttagtagtg |
7804873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 149
Target Start/End: Complemental strand, 35209527 - 35209499
Alignment:
| Q |
121 |
caagtgttaggtactagtaaatatcttgg |
149 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35209527 |
caagtgttaggtactagtaaatatcttgg |
35209499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University