View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2673_high_22 (Length: 309)
Name: NF2673_high_22
Description: NF2673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2673_high_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 36599225 - 36599495
Alignment:
| Q |
1 |
gttgagagtcttgctcttgatcagtgcttggtcgggcaatattttcttttttcgtgcagtgtttatgcaacaaccttgtatggcagcttatcattattct |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
36599225 |
gttgagagtct-gctcttgatcagtgcttggtcgggcaatattttctttgtttgtgcagtgtttatgcaacaaccttatatggcagcttatcactattct |
36599323 |
T |
 |
| Q |
101 |
tcacggtggagtttgcaatcatattacc-tcatcgtctcaagattgccataaacatggcgatctctacaaccttcccataatcaggtgctttgtcactgc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||| || | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36599324 |
tcacggtggagtttgcaatcatattaccatcgttatttcaagattgccataaacatggcgatctctacaaccttcccataatcaggtgctttgttgctgc |
36599423 |
T |
 |
| Q |
200 |
cttgtgagcagtccaggaactcggttcagcataagtaatacagaggacaccttgtcggaacgacgtcatacag |
272 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36599424 |
cttgtgagcagtccaggaactcggtt-agcataagtaatacagaggacaccgtgtcggaacgacgtcatacag |
36599495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University