View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2673_high_23 (Length: 299)
Name: NF2673_high_23
Description: NF2673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2673_high_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 295
Target Start/End: Complemental strand, 6843107 - 6842815
Alignment:
| Q |
1 |
ggtacagaaaatacactgaaaatatgtttctatttttctccttgagcgcaaaatcgtgctctgatttttgaccatcgtgccccgannnnnnnatgaggca |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
6843107 |
ggtacagaaaatacgctgaaaatatgtttctatttttctccttgagcgcaaaatcgtgctc--atttttgaccatcgtgccccgatttttttatgaggca |
6843010 |
T |
 |
| Q |
101 |
aaactcccaaagctgcacccaaaattgtggcctgatttctccggatagtggcctgatttttgcagaacttcaagcatcaatttcgagtcacaaacaacag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6843009 |
aaactcccaaagctgcacccaaaattgtggcctgatttcttcggatagtggcccgatttttgcagaactccaagcatcaatttcgagtcacaaacaacag |
6842910 |
T |
 |
| Q |
201 |
cccacatgaatgctaactctaacacttcaaaatgtatgcagcatctgtagggaacaaactttataatgcacacttgcatacaagtattatctacc |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6842909 |
cccacatgaatgctaactctaacacttcaaaatgtatgcagcatctgtagggaacaaactttataatgcacacttgcatacaagtattaactacc |
6842815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 93 - 166
Target Start/End: Original strand, 15824046 - 15824119
Alignment:
| Q |
93 |
atgaggcaaaactcccaaagctgcacccaaaattgtggcctgatttctccggatagtggcctgatttttgcaga |
166 |
Q |
| |
|
|||| |||||||||||||| ||||||| |||| ||||||| |||| ||| || ||||||||||||| ||||| |
|
|
| T |
15824046 |
atgaagcaaaactcccaaaactgcaccaaaaaatgtggcccaatttatccaaattgtggcctgattttggcaga |
15824119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 98 - 138
Target Start/End: Original strand, 26613688 - 26613728
Alignment:
| Q |
98 |
gcaaaactcccaaagctgcacccaaaattgtggcctgattt |
138 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||| |||||| |
|
|
| T |
26613688 |
gcaaaactcccaaaactgcactcaaaattgtggcttgattt |
26613728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University