View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2673_high_29 (Length: 269)
Name: NF2673_high_29
Description: NF2673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2673_high_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 27296309 - 27296071
Alignment:
| Q |
1 |
acactgatggaattcacttacagaactcaagagatgtattgatatacaaaagtactatggcttgcggtaatatttcaattacggataaattattggacat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27296309 |
acactgatggaattcacttacagaactcaagagatgtattgatatacaaaagtactatggcttgcggtaatatttcaattacggataaattattgcacat |
27296210 |
T |
|
| Q |
101 |
ttcgatttatcgaaacaacagttggtaactagtccatgcagaactccatgttttgaacttttcttaactgttatgcaggagatgattgtatttccataca |
200 |
Q |
| |
|
||| ||||||| |||||||||||||| | ||| ||| | ||||||||||| || ||| |||||||||||||||||||||||| ||||| |
|
|
| T |
27296209 |
ttctatttatccaaacaacagttggt-attaggcca-------------ggtttgaactttt-tttactattatgcaggagatgattgtatttctataca |
27296125 |
T |
|
| Q |
201 |
aactggatgctcaaacgtatacgtacacaatgtcgactgtggaccagggcatgg |
254 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27296124 |
aactggatgctcaaatgtatacgtacacaatgtcgactgtggaccagggcatgg |
27296071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 172 - 242
Target Start/End: Original strand, 14738520 - 14738590
Alignment:
| Q |
172 |
tatgcaggagatgattgtatttccatacaaactggatgctcaaacgtatacgtacacaatgtcgactgtgg |
242 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||| ||||| |||||||||||| ||||||| |
|
|
| T |
14738520 |
tatgcaggagatgattgcatttctatacaaactggatgctcaaatgtatatgtacacaatgtcaactgtgg |
14738590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University