View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2673_high_32 (Length: 257)
Name: NF2673_high_32
Description: NF2673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2673_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 241
Target Start/End: Original strand, 34608454 - 34608675
Alignment:
| Q |
17 |
gttgttatgctcacttttaaatcttttgttttcgtacaagttaatcaagtccaagaaatgtttgatcattgatagttgtagtgccttggtaaatgaattt |
116 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34608454 |
gttgttatgctcgcttttaaatcttttgttttcgtacaagttaatcaagtccaagaaatgtttgatcattgatagttgtagtgccttggtaaatgaattt |
34608553 |
T |
 |
| Q |
117 |
gaaagattaaaaaatgatatggttggtctgagaggatgattattgagctgcttagatatgccgcctattgaggttgatatgtcgatatgcatgtcgtctg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
34608554 |
gaaagattaaaaaatgatatggttggtctgagaggatg---attgagctgcttagatatgccgcctattgaggttgatatgccgatatgcatgttgtctg |
34608650 |
T |
 |
| Q |
217 |
cctggttctgctgaactatggtgag |
241 |
Q |
| |
|
||||||||||||||| | ||||||| |
|
|
| T |
34608651 |
cctggttctgctgaattgtggtgag |
34608675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University