View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2673_high_34 (Length: 243)
Name: NF2673_high_34
Description: NF2673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2673_high_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 20 - 220
Target Start/End: Original strand, 13055545 - 13055744
Alignment:
| Q |
20 |
ataccccctagcacttgaaattttgccccatcacttaatcgatggagttcactttgcttcttattcctccatgtaacaaggattttacataagaaaatgc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
13055545 |
ataccccctagcacttgaaattttgccccatcacttaatcgatcgacttcactttgcttcttattcctcc-tataacaaggattttacataagaaaatgc |
13055643 |
T |
|
| Q |
120 |
gaaatcctgaagtggatatgctatcattgattgtatcttgataagtctccacaattagggatagaaaagcatgctggtcttaacctttatcttgattagt |
219 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13055644 |
gaaatcctgaagtggatgtgctatcattgattgtatcttgataagtctccacaattagggatagaaaagcatgctggtcttaccctttatcttgattagt |
13055743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University