View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2673_low_35 (Length: 250)
Name: NF2673_low_35
Description: NF2673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2673_low_35 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 76 - 250
Target Start/End: Complemental strand, 44454545 - 44454371
Alignment:
| Q |
76 |
aaaaatatttctcccatttgggtcctttatctatcaaaatgtgcgcaaattaacttttttatcattatggctttttgtttgtttatactctatcttgatt |
175 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44454545 |
aaaaatatttgtcccatttgggtcctttatctatcaaaatgtgcgcaaattaacttttttatcattatggctttttgtttgtttatactctatcttgatt |
44454446 |
T |
|
| Q |
176 |
ccaactgcgacttacaccatcttttaaataaatcaatgaatatttgtctttgaataggaggctatttgcaaacaa |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44454445 |
ccaactgcgacttacaccatcttttaaataaatcaatgaatatttgtctttgaataggaggctatttgcaaacaa |
44454371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 87 - 128
Target Start/End: Original strand, 6719753 - 6719794
Alignment:
| Q |
87 |
tcccatttgggtcctttatctatcaaaatgtgcgcaaattaa |
128 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||| |||||||| |
|
|
| T |
6719753 |
tcccatttaggtcctttatctattaaaatgtgcacaaattaa |
6719794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University