View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2673_low_44 (Length: 207)
Name: NF2673_low_44
Description: NF2673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2673_low_44 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 20 - 207
Target Start/End: Original strand, 38286727 - 38286914
Alignment:
| Q |
20 |
tgacaagaactatgttaacattgttgttacaaaaggcctgaaatttaaatttttgaatacataatggtttcttccttttcaaatctttcacaaagtgaga |
119 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
38286727 |
tgacatgaactatgttaacattgttgttacaaaaggcctgaaatttaaatttttgaatacataatgatttcttccttttcaaatctttcacaaagtgaaa |
38286826 |
T |
|
| Q |
120 |
cagaaaatctatttgatctattttttccgtgggatccagattggcaacattcggttgttaattagtactgcctctcggtttcttttca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38286827 |
cagaaaatctatttgatctattttttccgtgggatccagattggcaacattcggttgttaattagtactgcctctcggtttcttttca |
38286914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University