View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2673_low_8 (Length: 528)
Name: NF2673_low_8
Description: NF2673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2673_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 447; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 447; E-Value: 0
Query Start/End: Original strand, 19 - 518
Target Start/End: Complemental strand, 22654213 - 22653714
Alignment:
| Q |
19 |
caaatcacaagttatctcatctgggtatcttccaagaccaccaaacaagcttaggtttcatcacaatgttagtctcactgtttcaattactattggcann |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22654213 |
caaatcacaagttatctcatctgggtatcttccaagaccaccaaacaagcttaggtttcatcacaatgttagtctcactgtttcaattactattggcacc |
22654114 |
T |
|
| Q |
119 |
nnnnnacaaaacgtgtcattagtcattgacacaggaagtgaactttcatggcttcattgcaacaactcaacaaaccgggtcatgctcgacccggtattta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
22654113 |
cccccacaaaacgtgtcattagtcattgacacaggaagtgaactttcatggcttcattgcaacaactcaacaaaccgggtcatgcctgacccggttttta |
22654014 |
T |
|
| Q |
219 |
acccgaatttttcttcttcttacaaacctatttcttgttcttcatctacatgcactactcaaacccgagattttcccatacctgcttcatgtgactccaa |
318 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22654013 |
acccgaatttttcttcttcatacaaacctatttcttgttcttcatctacatgcactacccaaacccgagattttcccatacctgcttcatgcgactccaa |
22653914 |
T |
|
| Q |
319 |
caatcattgccatgcaactctttcatacgcagatttttcttcctctgaagggaaccttgcttctgattcattcgggtttggaggatccgataacccggga |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22653913 |
caatcattgccatgcaactctttcatacgcagatttttcttcctctgaagggaaccttgcttctgattcattcgggtttggagcatccgataacccggga |
22653814 |
T |
|
| Q |
419 |
attgtatttgggtgtatggactcaagcattagcacaaactctgatggagattttaacacaaccgggttaatgggtatgaatctcgggtctctctcctttg |
518 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22653813 |
attgtatttgggtgtatggactcaagcattagcacaaactctgatggagattttaacacaaccgggttaatgggtatgaatctcgggtctctctcttttg |
22653714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University