View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2674_high_16 (Length: 276)
Name: NF2674_high_16
Description: NF2674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2674_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 41764554 - 41764295
Alignment:
| Q |
1 |
accaccacaaactcagcacccttcctcatttctcccatcgtccctcatatacccaagccccacctcactaccacccgctgcccgccattcctttctcccc |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41764554 |
accacaacaaactcagcacccttcctcatttctcccatcgtcccccatactcccacgccccacctcactaccacccgctgcctgccattcctttctcccc |
41764455 |
T |
 |
| Q |
101 |
tccttcgttaacaaattaaaattattgtcggtgtcacaattaaatgtcaaccctaccttcttgccaatatccttaacatcatccaccgccgcttgatgtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41764454 |
tccttcgttaacaaattaaaattattgccggtgtcacaattaaatgtcaaccctaccttcttgccaatatccttaacatcatccaccgccgcttgatgct |
41764355 |
T |
 |
| Q |
201 |
ttccatggagaataacccaaatttcccaagcatgattgattgaagaatttgagtttttag |
260 |
Q |
| |
|
|||||||||||||||||||| |||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
41764354 |
ttccatggagaataacccaattttcacaatcatgattgattgaagaatttgagtttttag |
41764295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University