View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2674_high_19 (Length: 240)
Name: NF2674_high_19
Description: NF2674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2674_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 64 - 210
Target Start/End: Complemental strand, 37437226 - 37437085
Alignment:
| Q |
64 |
caatatccatcaagacgtggagtgattctcatcatcccccattacaagtttattatcatttgctttttctgaacacatgacagtaagtaacaagcaaact |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37437226 |
caatatccatcaagacgtggagtgattctcatcatcccccattacaagtttattatcatttgctttttctgaacacatgaca----gtaacaagcaaact |
37437131 |
T |
 |
| Q |
164 |
aaaaacaacaataaactagaaaaattcatgattccagttggaacata |
210 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37437130 |
aaaaacaacaat-aactagaaaaattcatgattccagttggaacata |
37437085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 37437319 - 37437258
Alignment:
| Q |
1 |
gtcagcaaggtctgggtatagacttatggtaacaaattaagcttcattgaaataaataacca |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37437319 |
gtcagcaaggtctgggtatagacttatggtaacaaattaagcttcattgaaataaataacca |
37437258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University