View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2674_low_12 (Length: 370)
Name: NF2674_low_12
Description: NF2674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2674_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 101 - 352
Target Start/End: Complemental strand, 1419389 - 1419137
Alignment:
| Q |
101 |
caaaaatgggaaaagtattattagaagaatttgtcaaggtacaattggaccaagataatatttggaggcctccttcaccagtcttgtctaaagaatttga |
200 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1419389 |
caaaaatggaaaaaatattattagaagaatttgtcaaggtacaattggaccaagataatatttggaggcctcctccaccagtcttgtctaaagaatttga |
1419290 |
T |
 |
| Q |
201 |
tttaacttaagtagtataatttggtagtaacgaaaatatatggaacagcttgaatttggtctt-ttttgtagaagcagtaagtaaatatcatcaattcat |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1419289 |
tttaacttaagtagtataatttggtagtaacgaaaatatatggaacagcttgaatttggtctttttttgtagaagaagtaagtaaatatcatcaattcat |
1419190 |
T |
 |
| Q |
300 |
atcaaacaaaacaatcagcaaagtaaaatgagaagcagcgtagtatgtgatga |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1419189 |
atcaaacaaaacaatcagcaaagtaaaatgagaagcagcgtagtatgtgatga |
1419137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University