View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2674_low_21 (Length: 259)
Name: NF2674_low_21
Description: NF2674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2674_low_21 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 10 - 259
Target Start/End: Original strand, 30501075 - 30501324
Alignment:
| Q |
10 |
agcagagacagacataaaagaatttaaccaaacgaatcaccaatttcattttannnnnnngggcaggaaaccaccctaattagagtcttttgcaccccgg |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30501075 |
agcagaaacagacataaaagaatttaaccaaacgaatcgtcaatttcattttatttttttgggcaggaaaccaccctaattagagtcttttgcaccccgg |
30501174 |
T |
|
| Q |
110 |
tggctccacagtgtatcccccacaagctttgatactttagacctgttataggactaatctctctttggtgcttaggccatagcttaaagtttgcgaggat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30501175 |
tggctccacagtgtatcccccacaagctttgatactttagaccggttataggactaatctctctttggtgcttaggccataacttaaagtttgcgaggat |
30501274 |
T |
|
| Q |
210 |
caaactttggtcgtccctcaaaaagctcggtgcaggttaaccaactgagc |
259 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30501275 |
caaactttggtcgtccctcaaaaagctcgctgcaggttaaccaactgagc |
30501324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University