View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2675_high_11 (Length: 316)
Name: NF2675_high_11
Description: NF2675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2675_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 16 - 302
Target Start/End: Complemental strand, 30495811 - 30495525
Alignment:
| Q |
16 |
atgcctgagcactagcaggtgaagatgataagtcccataattcttcatgctgaatgacttgtccactaatttggttaagagtaaatttggaagtaactct |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30495811 |
atgcctgagcactagcaggtgaagatgataagtcccataattcttcatgcttaatgacttgtccactaatttggttaagagtaaatttggaagtaactct |
30495712 |
T |
 |
| Q |
116 |
gagtatgagaccccctcctacaccagctagaatagatttaggcttccctctaattgtccacttgatacttaaaacacttgttgacagcattgtcatttcc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30495711 |
aagtatgagaccccctcctacaccagctagaatagatttaggcttccctctaattgtccacttgatacttaaaacacttgttgacagcattgtcatttcc |
30495612 |
T |
 |
| Q |
216 |
tgcacagtctgttaaccaaacaaaacagatttcataagaatccaaccttcctttttgtcaaatttattttttaatattaataagtga |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30495611 |
tgcacagtctgttaaccaaacaaaacagatttcataagaatcctaccttccttttcgtcaaatttattttttaatattaataagtga |
30495525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University