View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2675_high_20 (Length: 261)
Name: NF2675_high_20
Description: NF2675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2675_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 11 - 230
Target Start/End: Complemental strand, 37153351 - 37153133
Alignment:
| Q |
11 |
cagagaaagaaaaatatgtatatcctatcaaaatggtcnnnnnnnctcctacaattttaaaacaaatcactttcaattgttgatccaaaacatctactgc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37153351 |
cagagaaagaaaaatatgtatatcctatcaaaatggtctttttttctcctataattttaaaacaaatcactttcaattgttgatccaaaacatctactgc |
37153252 |
T |
|
| Q |
111 |
tacaacttgagccaaattgagcaccgccgcatatgtacacaagatgacgatcatgattagggtgtgttactcacttatacaattctttattactggattc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37153251 |
tacaacttgagccaaattgagcaccgccgcatatgtacac-agatgacgatcatgatttgggtgtgttactcacttatacaattcttaattactggattc |
37153153 |
T |
|
| Q |
211 |
ttgttaatcattgttatgag |
230 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
37153152 |
ttgttaatcattgttatgag |
37153133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University