View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2675_high_29 (Length: 239)
Name: NF2675_high_29
Description: NF2675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2675_high_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 28553404 - 28553627
Alignment:
| Q |
1 |
tcaggtcgtagggatcgcgacttatgtcttttaagtcttcaaaattcataatcagttgcatccggatgaaattttgaaattatagagaatatttcagtat |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28553404 |
tcaggtcgtagggatcgcaccttatgtcttttaagtcttcaaaattcataatcagttgcatctggatgaaattttgaaattatagataatatttcagtat |
28553503 |
T |
 |
| Q |
101 |
acgcttgcgtgtcgcgtaggactctacgtgcgttacat-ggttcagttgaactagcttcacagttaggcatcaaatgcatatctagcgtagattaacatt |
199 |
Q |
| |
|
| ||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28553504 |
atgcttgcgcgtcgcgtaggactctacgtgcgttacatgggttcagttgaactagcttcacagttaggcat--aatgcatatctagcgtagattaacatt |
28553601 |
T |
 |
| Q |
200 |
gtgtaatagtatcatctgaatccatg |
225 |
Q |
| |
|
|||||||||||| ||||||||||||| |
|
|
| T |
28553602 |
gtgtaatagtataatctgaatccatg |
28553627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University