View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2675_high_29 (Length: 239)

Name: NF2675_high_29
Description: NF2675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2675_high_29
NF2675_high_29
[»] chr7 (1 HSPs)
chr7 (1-225)||(28553404-28553627)


Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 28553404 - 28553627
Alignment:
1 tcaggtcgtagggatcgcgacttatgtcttttaagtcttcaaaattcataatcagttgcatccggatgaaattttgaaattatagagaatatttcagtat 100  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||    
28553404 tcaggtcgtagggatcgcaccttatgtcttttaagtcttcaaaattcataatcagttgcatctggatgaaattttgaaattatagataatatttcagtat 28553503  T
101 acgcttgcgtgtcgcgtaggactctacgtgcgttacat-ggttcagttgaactagcttcacagttaggcatcaaatgcatatctagcgtagattaacatt 199  Q
    | ||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||    
28553504 atgcttgcgcgtcgcgtaggactctacgtgcgttacatgggttcagttgaactagcttcacagttaggcat--aatgcatatctagcgtagattaacatt 28553601  T
200 gtgtaatagtatcatctgaatccatg 225  Q
    |||||||||||| |||||||||||||    
28553602 gtgtaatagtataatctgaatccatg 28553627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University