View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2675_low_11 (Length: 405)
Name: NF2675_low_11
Description: NF2675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2675_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 74; Significance: 8e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 16 - 89
Target Start/End: Complemental strand, 34109087 - 34109014
Alignment:
| Q |
16 |
atattaatataagaaataataagggatctatatcatgtgtgggggagggaggggttgcagcccatggctgcccc |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34109087 |
atattaatataagaaataataagggatctatatcatgtgtgggggagggaggggttgcagcccatggctgcccc |
34109014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 56 - 101
Target Start/End: Original strand, 6417723 - 6417768
Alignment:
| Q |
56 |
gggggagggaggggttgcagcccatggctgcccctctatagatccg |
101 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || |||||||| |
|
|
| T |
6417723 |
gggggagggaggggttgctgcccatggctgcccccctctagatccg |
6417768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University