View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2675_low_22 (Length: 293)
Name: NF2675_low_22
Description: NF2675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2675_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 29 - 283
Target Start/End: Complemental strand, 15303949 - 15303696
Alignment:
| Q |
29 |
tttatttatgcttttctcatcaaattattccactccctttaggttacattatcattgacgtaatcaaacacgccgatttctctgaatgcttatacggttt |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | ||||||||| |||||||||||||||||||||||| ||| |
|
|
| T |
15303949 |
tttatttatgcttttctcatcaaattattccactccctttaggttacatgatcattgacatgatcaaacacaccgatttctctgaatgcttatacgattt |
15303850 |
T |
|
| Q |
129 |
aggggtacgtatatatatcacttctggttatatgcttcaattgttgcattcttttccttttgaacgaacactgttactgttattttctttgtttttcttg |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| ||||||||||||||||||||||||| |
|
|
| T |
15303849 |
aggggtacgtatatatatcacttctggttatatgcttcaattgttgcattcttttccttttgaactaa-actaacactgttattttctttgtttttcttg |
15303751 |
T |
|
| Q |
229 |
ttttagatgtgtgctaaagaactcataattcctagtgatacccctgatccctatg |
283 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15303750 |
tcttagatgtgtgctaaagaactcataattcctagtgatacccctgatccctatg |
15303696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University