View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2675_low_34 (Length: 247)
Name: NF2675_low_34
Description: NF2675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2675_low_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 230
Target Start/End: Complemental strand, 23314796 - 23314584
Alignment:
| Q |
18 |
acaaccatcaacccctatgaaaggcctgcaactggtctttaaagctctcttgcaaccatcaaagcatacataaaacctaccaaatctgggtaacaaagtt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23314796 |
acaaccatcaacccctatgaaaggcctgcaactggtctttaaagctctcttgcaaccatcaaagcatacataaaacctaccaaatcttggtaacaaagtt |
23314697 |
T |
|
| Q |
118 |
ggtactggtctttccaaatgcaacttataagtattcccgctgcatgctctttgtaactcagcactataagaccaaatcattgaatattgtttctcaaaat |
217 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||| |||| ||||||||||||||| ||||||||||||| |||||||||||||||||||||| || |
|
|
| T |
23314696 |
ggtactggtctttcgaaatgcaacttacaagtattcccgttgcacgctctttgtaactcaccactataagaccagatcattgaatattgtttctcaatat |
23314597 |
T |
|
| Q |
218 |
caccatccactat |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
23314596 |
caccatccactat |
23314584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University