View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2675_low_36 (Length: 244)
Name: NF2675_low_36
Description: NF2675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2675_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 24522998 - 24523222
Alignment:
| Q |
1 |
tgatggtagatccgttgttgagagagtacttccgaacggagatttctatgccggaagtttctccggtaacgtaccgaatggatccgggaagtatctatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24522998 |
tgatggtagatccgttgttgagagagtacttccgaacggagatttctatgccggaagtttctccggtaacgtaccgaatggatccgggaagtatctatgg |
24523097 |
T |
|
| Q |
101 |
accgacggttgcatgtacgaaggtgaatggaaacgaggtaaagcttcagggaaagggaaattttcatggccttcaggcgcgacttacgagggagagttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24523098 |
accgacggttgcatgtacgaaggtgaatggaaacgaggtaaagcttcagggaaagggaaattttcatggccttcaggcgcgacttacgagggagagttca |
24523197 |
T |
|
| Q |
201 |
agtcgggtcgaatggaaggattcgg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
24523198 |
agtcgggtcgaatggaaggattcgg |
24523222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 97 - 177
Target Start/End: Original strand, 32937157 - 32937237
Alignment:
| Q |
97 |
atggaccgacggttgcatgtacgaaggtgaatggaaacgaggtaaagcttcagggaaagggaaattttcatggccttcagg |
177 |
Q |
| |
|
||||| ||| ||||| || ||||||||||||||||||||||| |||||||| || || || ||||| || ||||||||||| |
|
|
| T |
32937157 |
atggaacgatggttgtatctacgaaggtgaatggaaacgaggaaaagcttccggaaatggtaaattctcgtggccttcagg |
32937237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University