View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2675_low_37 (Length: 239)
Name: NF2675_low_37
Description: NF2675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2675_low_37 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 33222766 - 33222986
Alignment:
| Q |
19 |
ggctgtatccttcatcatcttcactctcatcatcttcttttatcatgtcgatgtttgcatgatttccaagtgttacgcaatactcgtcaccgcaaagact |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33222766 |
ggctgtatccttcatcatcttcactctcatcatcttcttttatcatgtcgatgtttgcatgatttccaagtgttacgcaatactcatcaccgcaaagact |
33222865 |
T |
|
| Q |
119 |
gtttcccatgtgattacagacttacacagacatgtacaacactagaaagggtcttaactagtttaaggctgtgttcattatttgagaaatttataagcat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33222866 |
gtttcccatgtgattacagacttacacacacatgtacaacactagaaagggtcttaactagtttaaggctgtgttcattatttgagaaatttataagcat |
33222965 |
T |
|
| Q |
219 |
aactaaaatcaaatattttct |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
33222966 |
aactaaaatcaaatattttct |
33222986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 22 - 89
Target Start/End: Original strand, 33231322 - 33231389
Alignment:
| Q |
22 |
tgtatccttcatcatcttcactctcatcatcttcttttatcatgtcgatgtttgcatgatttccaagt |
89 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||| ||||| |||| | |||| |||| ||||| |
|
|
| T |
33231322 |
tgtatcctccatcatcgtcactctcatcatcttcttttaccatgttgatggtagcattattttcaagt |
33231389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University