View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2675_low_8 (Length: 421)

Name: NF2675_low_8
Description: NF2675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2675_low_8
NF2675_low_8
[»] chr5 (1 HSPs)
chr5 (1-197)||(26421380-26421576)


Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 26421380 - 26421576
Alignment:
1 aaaaataagtggacttaaaatctagcaggagaacgagaggagggatgaaaattaagaggtttggactagatggagtaaaatcaccgtacagtcactactt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
26421380 aaaaataagtggacttaaaatctagcaggagaacgagaggagggatgaaaattaagaggtttggactagatggagtaaaatcaccatacagtcactactt 26421479  T
101 tcagaagcataacgagggtagggatgagaaataagaggtttggattagatggagtataaacagcatgcagtcactactttcagaagcatatgagact 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
26421480 tcagaagcataacgagggtagggatgagaaataagaggtttggattagatggagtataaacaccatgcagtcactactttcagaagcatatgagact 26421576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University