View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2676_low_8 (Length: 241)
Name: NF2676_low_8
Description: NF2676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2676_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 225
Target Start/End: Complemental strand, 5365609 - 5365402
Alignment:
| Q |
18 |
aaaagttatgaaggaaattggtgctagaatggaaaaattcgcaagactcatgggagttccatttaaattcaacgttattcatcactccggcgatctttct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5365609 |
aaaagttatgaaggaaattggtgctagaatggaaaaattcgctagactcatgggagttccatttaaattcaacgttattcatcactccggcgatctttct |
5365510 |
T |
|
| Q |
118 |
gatttgaattttttggatttagatattaaagaagatgaagctttagctgttaattgtgttaatgctttgcattcagtaacagttggcaatggtaatggta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5365509 |
gatttgaattttttggatttagatattaaagaagatgaagctttagctgttaattgtgttaatgctttgcattcagtaacagttggcaatggtaatggta |
5365410 |
T |
|
| Q |
218 |
acggtaat |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
5365409 |
acggtaat |
5365402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 89
Target Start/End: Original strand, 39987731 - 39987802
Alignment:
| Q |
18 |
aaaagttatgaaggaaattggtgctagaatggaaaaattcgcaagactcatgggagttccatttaaattcaa |
89 |
Q |
| |
|
|||||| ||||||||||||||| | || ||||||||||| || || || |||||||| || ||||||||||| |
|
|
| T |
39987731 |
aaaagtcatgaaggaaattggttcaaggatggaaaaatttgctaggcttatgggagtgccgtttaaattcaa |
39987802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 161
Target Start/End: Original strand, 39987840 - 39987868
Alignment:
| Q |
133 |
gatttagatattaaagaagatgaagcttt |
161 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39987840 |
gatttagatattaaagaagatgaagcttt |
39987868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University