View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2678_high_10 (Length: 241)
Name: NF2678_high_10
Description: NF2678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2678_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 20 - 222
Target Start/End: Original strand, 37534481 - 37534683
Alignment:
| Q |
20 |
acaagagtagcagtgtgactttcccttggtgaaggtggtatcccttcacatttaggcttaatccattcttttgtgtaaagatcaagtatatgagtttcat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37534481 |
acaagagtagcagtgtgactttcccttggtgaaggtggtatcccttcacatttaggcttaatccattcttttgtgtaaagatcaagtatatgagtttcat |
37534580 |
T |
 |
| Q |
120 |
tcactttcttgaaaccatttgtaccaccaaaaactatcattttgtgtcctacaagaacagcactatggctatctctaggacctggcttttcacctgttgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37534581 |
tcactttcttgaaaccatttgtaccaccaaaaactatcattttgtgtcctacaagaacagcactatggctatctctaggacctggcttttcacctgttgt |
37534680 |
T |
 |
| Q |
220 |
agt |
222 |
Q |
| |
|
||| |
|
|
| T |
37534681 |
agt |
37534683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University