View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2679_high_6 (Length: 252)

Name: NF2679_high_6
Description: NF2679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2679_high_6
NF2679_high_6
[»] chr4 (1 HSPs)
chr4 (78-150)||(53288906-53288982)


Alignment Details
Target: chr4 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 78 - 150
Target Start/End: Original strand, 53288906 - 53288982
Alignment:
78 tttttctctcttaataattg----atggataatttttaaaaaatagaatgtataccatttgccaaatttaatgcaaa 150  Q
    ||||||||||||||||||||    |||||||||||  ||||||||||||||||||||||||||||||||||||||||    
53288906 tttttctctcttaataattgattgatggataatttaaaaaaaatagaatgtataccatttgccaaatttaatgcaaa 53288982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University