View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2679_low_17 (Length: 201)
Name: NF2679_low_17
Description: NF2679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2679_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 55; Significance: 8e-23; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 26925551 - 26925493
Alignment:
| Q |
1 |
accggactgtgttgttgagtttatgatggaactagcggatgcatcactgcacttcttaa |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26925551 |
accggactgtgttgttgagtttatgatggaactagcggatgcatcaccgcacttcttaa |
26925493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University