View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2679_low_7 (Length: 389)
Name: NF2679_low_7
Description: NF2679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2679_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 83 - 319
Target Start/End: Complemental strand, 6972613 - 6972377
Alignment:
| Q |
83 |
cttctcatcaatattagacgtgtagtgtatttgggcatgtactacatctaactataatataataagttcgagaaggtttgatttctgattgtcccctttt |
182 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||| ||||||| |||||||||||| |||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
6972613 |
cttctcatcaatattagatgtgtagtgtaattgggcttgtactatatctaactataacataataggttcgagaaggtttgatttctgattgtcccatttt |
6972514 |
T |
 |
| Q |
183 |
aaccgtaataaaaagtatgtatcataactctcatccattttaactcgtgaacccgatcaaacctgaccgtttgcttgttgaaccatcatatttgggtggg |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6972513 |
aaccgtaataaaaagtatgtatcataactctcatccattttaactcgtgaacccgatcaaacctgaccgtttgcttgttcaaccatcatatttgggtggg |
6972414 |
T |
 |
| Q |
283 |
tttgatcgattcaatgtattgtgccacccctatgata |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6972413 |
tttgatcgattcaatgtattgtgccacccctatgata |
6972377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University