View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2681_high_18 (Length: 265)
Name: NF2681_high_18
Description: NF2681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2681_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 137 - 250
Target Start/End: Original strand, 52138363 - 52138476
Alignment:
| Q |
137 |
acgaacacagggagatgttagatctgcgggagtgagggaaattaaattgaagtgaaaaatcatagaaaaagctggatttttgttccgttgatgatgtttg |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52138363 |
acgaacacagggagatgttagatctgcgggagtaagggaaattaaattgaagtgaaaaatcatagaaaaagctggatttttgttccgttgatgatgtttg |
52138462 |
T |
 |
| Q |
237 |
ttgatgttgaatgt |
250 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
52138463 |
ttgatgttgaatgt |
52138476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 137 - 248
Target Start/End: Original strand, 9854457 - 9854568
Alignment:
| Q |
137 |
acgaacacagggagatgttagatctgcgggagtgagggaaattaaattgaagtgaaaaatcatagaaaaagctggatttttgttccgttgatgatgtttg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
9854457 |
acgaacacagggagatgttagatctgcgggagtgagggaaattaaattgaagtgaaaaatcatagaaacaactggatttttgttccgttgatgatgtttg |
9854556 |
T |
 |
| Q |
237 |
ttgatgttgaat |
248 |
Q |
| |
|
||||||| |||| |
|
|
| T |
9854557 |
ttgatgtggaat |
9854568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 155 - 193
Target Start/End: Complemental strand, 19709833 - 19709795
Alignment:
| Q |
155 |
tagatctgcgggagtgagggaaattaaattgaagtgaaa |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19709833 |
tagatctgcgggagtgagggaaattaaattgaagtgaaa |
19709795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University