View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2681_low_25 (Length: 237)
Name: NF2681_low_25
Description: NF2681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2681_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 13 - 90
Target Start/End: Complemental strand, 7091690 - 7091613
Alignment:
| Q |
13 |
aaggtgatattcaagttgaacttaaagaacattgtaggtgtgacataatttaaccaggaaggccatctaaatttgagc |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7091690 |
aaggtgatattcaagttgaacttaaagaacattgcaggtgtgacataatttaaccaggaaggccatctaaatttgagc |
7091613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 203
Target Start/End: Complemental strand, 7091534 - 7091504
Alignment:
| Q |
173 |
atgtagtaacgggtgaactttctacattttt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7091534 |
atgtagtaacgggtgaactttctacattttt |
7091504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University