View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2681_low_27 (Length: 203)
Name: NF2681_low_27
Description: NF2681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2681_low_27 |
 | |
|
| [»] scaffold0003 (2 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 19 - 186
Target Start/End: Original strand, 24494739 - 24494906
Alignment:
| Q |
19 |
attatacatccacctctgcacatgttacattttatggtggtaacccaatttcttggaagtcttttaaacaaaaagccgttgcaagatcatccactgaagc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24494739 |
attatacatccacctctgcacatgttacattttatggtggtaacccaatttcttggaagtcttttaaacaaaaagccgttgcaagatcatccactgaagc |
24494838 |
T |
|
| Q |
119 |
tgaatatagagctctagcatccgcatctgaagaagttctctggttgtcatcacttctctctgaacttc |
186 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24494839 |
tgaatatagagctctagcatccgcatctgcagaagttctctggttgtcatcacttctctctgaacttc |
24494906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 107; Significance: 8e-54; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 52 - 186
Target Start/End: Original strand, 86237 - 86371
Alignment:
| Q |
52 |
atggtggtaacccaatttcttggaagtcttttaaacaaaaagccgttgcaagatcatccactgaagctgaatatagagctctagcatccgcatctgaaga |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |||||| | ||| |
|
|
| T |
86237 |
atggtggtaacccaatttcttggaagtcttttaaacaaaaatttgttgcaagatcatccactgaagctgaatacagagctctagcatacgcatccgcaga |
86336 |
T |
|
| Q |
152 |
agttctctggttgtcatcacttctctctgaacttc |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
86337 |
agttctctggttgtcatcacttctctctgaacttc |
86371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 56
Target Start/End: Original strand, 94089 - 94126
Alignment:
| Q |
19 |
attatacatccacctctgcacatgttacattttatggt |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
94089 |
attatacatccacctctgcacatgttacattttatggt |
94126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 149 - 186
Target Start/End: Complemental strand, 18557123 - 18557086
Alignment:
| Q |
149 |
agaagttctctggttgtcatcacttctctctgaacttc |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18557123 |
agaagttctctggttgtcatcacttctctctgaacttc |
18557086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University