View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2681_low_9 (Length: 377)
Name: NF2681_low_9
Description: NF2681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2681_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 11 - 365
Target Start/End: Original strand, 42714543 - 42714897
Alignment:
| Q |
11 |
tagcataggatgatcagtgacttctttgattttgcatagaacttgtcttaattattgtagcagagaactggtgttattgtcaattcagtatttatgatca |
110 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42714543 |
tagcaaaggatgatcagtgacttctttgattttgcatagaacttgtcttaattattgtagccgagaactggtgttattgtcaattcagtatttatgatca |
42714642 |
T |
 |
| Q |
111 |
caaaatatcaggtttatttcattttttacttttaatttcatccaccttaaaacattcgaaaactgaacattgcatattcccttccatcttgagagaactc |
210 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42714643 |
caaaatgtcaggtttatttcattttttacttttaatttcatccaccttaaaacattcgaaaactgaacattgcatattcccttccatcttgagagaactc |
42714742 |
T |
 |
| Q |
211 |
gtgcattgcaaataccatnnnnnnncctttattgcaatgggaagaaaaagaaatacatcacttttaatagttgatagcaaatgtattattatgaaactaa |
310 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42714743 |
gtgcattgcaaataccataaaaaaacctttattgcaatgggaagaaaaagaaatacatcacttttaatagttggtagcaaatgtattattatgaaactaa |
42714842 |
T |
 |
| Q |
311 |
tacctcactaatgtgcattgttaagtgcaataggtatcccaacaacataattctt |
365 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42714843 |
tacctcactaatgtggattgttaagtgcaataggtatcccaacaacatagttctt |
42714897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University