View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2682_high_9 (Length: 243)
Name: NF2682_high_9
Description: NF2682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2682_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 19 - 126
Target Start/End: Complemental strand, 28767361 - 28767254
Alignment:
| Q |
19 |
gtgacatgggattgtaattgggggtagtagcccaactaacaacaactatagtgtattaataattatgggggtaataataacaacataaagtgcaagtggc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28767361 |
gtgacatgggattgtaattgggggtagtagcccaactaacaacaattatagtgtattaataattatgggggtaataataacaacataaagtgcaagtggc |
28767262 |
T |
|
| Q |
119 |
atagtagt |
126 |
Q |
| |
|
|||||||| |
|
|
| T |
28767261 |
atagtagt |
28767254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 145 - 218
Target Start/End: Complemental strand, 28767258 - 28767192
Alignment:
| Q |
145 |
gtagttgaactcctcaaccaaacacgtcacgtgcaagtaagtaatattaaataataacatggttggtttggttt |
218 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
28767258 |
gtagttgaactccttaaccaaacacgtcacgtgtaagtaagt-------aataataacatggttggtttggttt |
28767192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University