View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2683-Insertion-10 (Length: 105)
Name: NF2683-Insertion-10
Description: NF2683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2683-Insertion-10 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 5e-38; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 5e-38
Query Start/End: Original strand, 7 - 105
Target Start/End: Original strand, 32681269 - 32681374
Alignment:
| Q |
7 |
aaaaaatcccttcttaaaatttgagaaacttgtgttctgttccgtctcaa-------ccctgtgtgtgttactcttccgtgaatcaattcagattcttgt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32681269 |
aaaaaatcccttcttaaaatttgagaaacttgtgttctgttccgtctcaactgtcaaccctgtgtgtgttactcttccgtgaatcaattcagattcttgt |
32681368 |
T |
 |
| Q |
100 |
tgtgga |
105 |
Q |
| |
|
|||||| |
|
|
| T |
32681369 |
tgtgga |
32681374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University